The following post is a collaboration of a few different opinions by different people about Jeffrey P. Tomkins' article about debunking human chromosome fusion. We utilized different articles and methods of bioinformatics to either support or reject his claims.

Kameron:

After reading “New Research Debunks Human Chromosome Fusion”,  I believe that the article makes some plausible scientific arguments. One main point Tomkins makes, is that the type of fusion that is said to be the cause of the chromosomal evolution, has never been seen before. He states that there are two known types of fusion and they both have to deal with a sequence called satellite DNA. The two types of satDNA fusion are satDNA-satDNA or satDNA-telomereDNA. Although a telomere-telomere fusion has not been documented in nature before, Tomkins doesn’t go into much detail about why this is.

The sources that Tomkins uses are not very current. The most current source he uses is his own. He supports his own opinion with his own research. The sources he does use for other important information are very out of date. Majority of his information comes from sources that are over 10 years old. This tends to raise question to what kind of information is he basing this claim off of.

Tyler:

The following is just a summary of the article “New Research Debunks Human Chromosome fusion” by Jeffrey Tomkins. The author claims that the fusion site's location is in a gene. The gene is called DDX11L2, and contains a transcription factor binding site. This binding site is located on the first intron of the gene. The DX11L2 gene has 3 transcription binding sites and one is located on the fusion site. Also, chromosomes contain genes on both strands of the chromosome, and are encoded in opposite directions (Tomkins, 2013). On the reverse-oriented strand exists the DX11L2 gene, so it is read in the opposite direction. This means that the gene is not read forward, like most evidence claims (Tomkins, 2013). He also claims that, if you line up the chimp chromosome with the human fused chromosome, the genes around the fusion site do not match at all.

My thoughts? I felt that Tomkins makes a good argument for his case and has done some careful research, but, as Kameron mentions, his sources are outdated and of his own research. The sources that aren’t his own, are outdated by over 10 years. I took a look at a few “recent” articles, but found that there aren’t very many that were younger than 10 years, but there is one that talks in great detail about the DDX11L gene is present in multiple copies in primates genomes. The article was published in 2009 in  A small excerpt reads “ To investigate the conservation of DDX11L genes along the primate evolution, human sequences obtained from direct sequencing of each DDX11L gene copy (see "Genomic structure and localization of DDX11L genes" section) and from the public databases (NCBI), were aligned with the sequences derived from BLAST analysis on chimpanzee, rhesus and orangutan genomes, using ClustalW algorithm. The analysis revealed that the human DDX11L genes have a high degree of conservation along primates, showing up to 98% of sequence homology to subtelomeric sequences from chromosomes XI and XIV of chimpanzee, and 91% with the subtelomeric sequences from chromosome 13 of rhesus. No DDX11L homologous were found in the orangutan genome assembly. Both in chimpanzee and in rhesus, the DDX11L homologous genes revealed to overlap – as already shown in the humans – a gene homologous to the human WASH in the PAR2 of the X chromosome.” (Costa et el., 2009). I don’t want to bore you with all of the details, and you can find the article here, but it makes a great case for proving that there is a strong case for a common ancestor.

Kevin:

Jeffrey Tomkins argues against the evolutionary claim of the Chimp’s 2a and 2b Chromosomes fusing into the human Chromosome 2. One point Tomkin makes is that all known fusion of living beings associate a sequence known as Satellite DNA or SatDNA. This SatDNA could either fuse with another SatDNA or Telomere DNA. A Telomere to Telomere fusion would be the first documented case (Tomkins 2013). He also goes on to point out that in 2002, there were 614,000 bases of DNA surrounding the alleged fusion site that didn’t align with that of the Chimp’s(Tomkins 2013). He then talks about his published work on the debunking of the alleged fusion site. The site is located in a gene known as DDX11L2. The DDX11L2 gene contains three transcription factor binding sites, sites that have proteins that bind to regulatory sites in and around genes to control their function (Tomkins 2013).

Though Tomkins makes compelling arguments to debunk the claim that human evolved from ape, I feel that his sources were outdated. The most recent source he used aside from his own was published in 2008, 5 years from the time this article was published. His other sources were over a decade old. His other published work appears to have more updated references. In respects to opinion, I do not agree with Tomkins. In recent research, there have been reports of retrotransposons, mobile genetic entities that play roles in gene regulation, pathological conditions, and evolution (Denli 2015). So I ask, could such entities have had any impact on the DDX11L2 gene over the course of 6 million years?  

Ying:

In my point of view, Dr. Tompkins argument of chromosome fusion has the correct starting assumptions, but incorrect scientific arguments.

As stated in his paper “More DNA Evidence Against Human Chromosome Fusion”, Dr. Tomkins stated that the former evidence of a telomere-telomere fusion event on human chromosome 2 is unwarranted because first, the telomere-telomere sequence was only about 800 bases long—not the 10,000 bases or more you would expect if two 5,000-base (or larger) telomeres fused together; Second, the fusion-like sequence was very degenerate and only 70% similar to what one would expect of a pristine fusion sequence of the same size; Third, the fusion site contains no type of sequence called satellite DNA (satDNA).; Fourth, he declared that the alleged fusion signature on chromosome 2 is that it occurs in a region of the genome that is full of genes, while the telomeres do not contain genes. (Tomkins 2015)

Admittedly,  when I checked the NCBI genome sequence, I found the same problem. There seems no clear fusion site as a repetitive sequence of TTAGGG in the position 2q12-2q14.1 in human chromosome 2. However, when I checked the begining and the end sequence of the chimpanzee chromosome 2a, I found there is also no show of the DNA repeat motifs (TTAGGG) in the place that should be telomeres. In these area, there is only a sequence (NNNNNN), stands for the multiplex tag. Also, I checked the UCSC genome browser as method used by Dr. Tomkins, the gene sequence of chromosome 2: 1-10,000, the position of telomere, looks like follows:

>hg38_refGene_NM_001276352 range=chr1:67092176-67134971 5'pad=0 3'pad=0 strand=- repeatMasking=none
CGAGTAACCCGCGGAGCCAGAAGAGGGAGGAAAGGAGATGAGgtttgttt
cagggtgcggaagggttggaagagttgaaaatcaaaatttgcatgagggt
gggaggcgaaataggaaaaacgtcgttttacataaacggcctttctgtcc
ccggagtcggtgggacgttctccagcggggcctggaccgggagagtgtgg
ttgaggtcaggcaagtgtgggaccgcggcgagaggcgagcccggggggct
cttccaggttcgcggaagaaccctttgcatcttctaaactaaatattaat
gagcttcctcaatgttgcccttaattttgctttcccatgaaacgaccata
ggcatagagcgtttgagtcgggcttcctatgtttccagcgagatggaggc
acctgggggaaggtgactcggggccgggcaagagatgcgagaggctctgg
gggccgcttaattgatacatttccaaattgacgactcccaacatcctgga
atggatggtggaagctgatcgcccctgcggtaattgtgctgcgatttcga
gctggctaatcaattcttgcaatcattatctgattagtcgcccacaataa
tactccacaatccacgtacatcatagttttaaaattccttagtagttttt
cttagaaacttcccttccaggccggcgcgttggcttacgcctgtaatccc
agcactttgggaggccaaggcgggcggatcacttgaggtcaggagttaga
gaccagcctggccacagtggcgaaaccccgtctctactaaaaatacaaaa
attagccgggcatggtggtgggcgcctgtagtcccacctactggggaggc

(https://genome.ucsc.edu/cgi-bin/hgTables?hgsid=475474705_kgJKAhqexXmReoaiB12BNgIpLBqd&boolshad.hgSeq.promoter=0&hgSeq.promoterSize=1000&hgSeq.utrExon5=on&boolshad.hgSeq.utrExon5=0&hgSeq.cdsExon=on&boolshad.hgSeq.cdsExon=0&hgSeq.utrExon3=on&boolshad.hgSeq.utrExon3=0&hgSeq.intron=on&boolshad.hgSeq.intron=0&boolshad.hgSeq.downstream=0&hgSeq.downstreamSize=1000&hgSeq.granularity=gene&hgSeq.padding5=0&hgSeq.padding3=0&boolshad.hgSeq.splitCDSUTR=0&hgSeq.casing=exon&boolshad.hgSeq.maskRepeats=0&hgSeq.repMasking=lower&hgta_doGenomicDna=get+sequence)

It is not so like the DNA repeat motifs as TTAGGG. And in Dr. Tomkins paper, he stated that there is only 798 bp core sequence surrounding the fusion site on human chromosome 2, which sequenced as follows. (Tomkins 2011)

However, Fan el al. compared the fusion site of RP11-395L14 with an 1873-bp sequence from a different individual, and pointed out there is a high degree of variation in the lengeh and sequence of the head-to-head arrays of degenerate telomere repeats. So, in my opinion, the fusion site may not be as small as 798 bp as Dr. Tomkins declared.

Citations

Jeffrey P. Tomkins, Ph.D. 2013. New Research Debunks Human Chromosome Fusion.Acts & Facts. 42 (12).

Jeffrey P. Tomkins, Ph.D. 2015. More DNA Evidence Against Human Chromosome Fusion. Acts & Facts. 44 (8).

Fan, Y. et al. 2002. Genomic structure and evolution of the ancestral chromosome fusion site in 2q13-2q14.1 and paralogous regions on other human chromosomes.Genome Research. 12 (11):1651-1662.

Fan, Y. et al. 2002. Gene content and function of the ancestral chromosome fusion site in human chromosome 2q13-2q14.1 and paralogous regions. Genome Research. 12 (11): 1663-1672.

Tomkins, J. P. 2013. Alleged Human Chromosome 2 “Fusion Site” Encodes an Active DNA Binding Domain Inside a Complex and Highly Expressed Gene—Negating Fusion. Answers Research Journal. 6: 367-375.

Tomkins, J. and J. Bergman. 2011. The chromosome 2 fusion model of human evolution—part 2: re-analysis of the genomic data. Journal of Creation. 25 (2): 106－110.

Tomkins, J. and J. Bergman. 2011. The chromosome 2 fusion model of human evolution—part 2: re-analysis of the genomic data. Journal of Creation. 25 (2): 111-117.

Denli, Ahmet M. Narvaiza, Inigo. Kerman,Bilal E. Hunter,Tony. Saghatelian, Alan. Gage, Fred H. … “Primate-Specific ORF0 Contributes to Retrotransposon-Mediated Diversity”. web. <http://www.cell.com/cell/pdfExtended/S0092-8674(15)01187-3>

Costa, Valerio, Amelia Casamassimi, Roberta Roberto, Fernando Gianfrancesco, Maria R. Matarazzo, Michele D'urso, Maurizio D'esposito, Mariano Rocchi, and Alfredo Ciccodicola. "DDX11L: A Novel Transcript Family Emerging from Human Subtelomeric Regions." BMC Genomics 10.1 (2009): 250. Web.